Spongebob3934 Spongebob3934

15-11-2017
Biology

contestada

Spreading black necrosis, swelling, pain and froth or bubbles are characteristic of

Respuesta :

Sevenly Sevenly

15-11-2017

Rabies?
i really dont know xD

Answer Link

Otras preguntas

Ted is analyzing the sonnet “Composed upon Westminster Bridge, September 3, 1802.” As you read the sonnet, notice what the author says about urban and rural se

Figure ABCD is a parallelogram. which of the following must be true.

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the

Which of these human behaviors has the greatest potential to harm the environment? A. Use of technology to speed harvesting of resources B. Focus on steady har

In a typical symphony orchestra, 16 out of every 100 musicians are violinists. What fraction of the orchestra are violinists?

Which country is the top timber producing nation? A. Canada B. United States C. Mexico D. Brazil

What events in the first two years of bush's second term contributed to Republicans losing control of congress?

Select the items below that describe natural resources. Choose all that apply 1. renewable or nonrenewable 2. come from nature 3. include minerals, air, and su

write the equation in standard form 3x + 1 = 2y1. 3x + 2y = 12. 3x - 2y = 13. 3x + 2y = -14. 3x - 2y = -1

Bottom trawling is considered destructive because _______. a. it destroys sea floor habitats b. it depletes fish populations c. it shatters deep-sea coral d. al