Skullking Skullking

14-03-2018
Biology

contestada

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the above (Question 2) transcription.

Respuesta :

bluenote bluenote

14-03-2018

3’ tcgccctactcgcgtacaccgcgtattgac 5’ turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)

Answer Link

Otras preguntas

If y =12 when x= 6, find x when y=-24

which achievements are most closely associated with the golden age of Islamic cult

Given that S^3 on the bottom 1 (e^x)dx=(e^3)-e use the properties of integrals and this result to evaluate S^3 on the bottom 1 (5e^x − 1) dx. I got 5e^3x-5e-1 i

What is 16/64 in its lowest terms

At a water park, a one-day ticket costs $72.50 per adult. Which equation can be used to calculate the one-day ticket price, W, for n adults? n = 72.50W W equals

What value of x makes the ratios equivalent? three over x equals eighteen over twelve 2 4 6 9

Simplify using positive exponents. m^3n^–6p^0

Solve x2 = 144. 72 12 ±12 −12

tom uses water from a full tank to fill 6 bottles that each hold 16 ounces and a pitcher that holds 1\2 gallon. how many ounces of water are left in the water t

He collected several honors as he aged and Kennedy asked him to read a poem at the presidential inauguration in 1961 A complete sentence B run-on C fragment