15-10-2015
Mathematics

contestada

josh pays 7.59 for 2.2 pounds of ground turkey. what is the price per pound of the ground turkey?

Respuesta :

AsiaWyche AsiaWyche

15-10-2015

The answer to this is $3.45 all you had to do was divide (/) 7.68/2.2 and get the total of $3.45

Answer Link

Otras preguntas

The graph of a function is shown below. What is true about the function on the interval -5< x < -2?

2. Which system has an infinite number of solutions? a. x+2=y 4= 2y-x b. 2y + 6 = 4x -3=y-2x c. y+3=2x 4x=2y-3 d. y = 2x - 5 -2 = y - 2x

Talhah and Rosina are doing push ups for PE class. They both want to complete the same number of push ups, but Talhah wants to do 6 push ups per set and Rosina

Question 4 of 34 You need to calculate the enthalpy change (AH) of the reaction A + B → C. How can the enthalpies given for the reaction steps below be combined

How many years would it take a 6000$ loan at 5% to earn 12000$ in interest?

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated

What is the pH during a weak acid-strong base titration after the addition of 30.00 mL of 0.400 M NaOH to 25.0 mL of aqueous 0.48 M hydrofluoric acid? KA= 6.76×

Describe patterns in a simple model for waves that includes how the amplitude of a wave is related to the energy in a wave.

Atmospheric air at 1atm ,30°C and 80% relative humidity is cooled to 20°C while the mixture pressure remains constant . Calculate the amount of water in kg/kg d

Please help!! In the diagram, ΔMTD ≅ ΔGLS . Which statement is true? ∠M ≅ ∠G DT ≅ LG DM ≅ SL ∠T ≅ ∠S