104170angel 104170angel

11-12-2022
Biology

contestada

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated DNA strand) GTAGTAGTAGGAGTAGTAGTA. What type of mutation is illustrated? A insertion B Translocation C Substitution D Deletion

Respuesta :

Otras preguntas

What is the answer???

Which one of the following best illustrates impressment? A.Britain occupied forts along the northwestern boundary of the United States. B.Britain took over the

Question 9 (2 points) Question 9 Unsaved Elige la palabra que completa la oración siguiente. Mi abuela _____ un pastel grandísimo anoche ___________ mi fiesta d

Suppose the sunk cost of obtaining your college degree is $50,000, the marginal cost is $175,000, and the marginal benefit is $200,000. marginal analysis implie

Q and R are mutually events. If P(Q)=0.18 and P(R)=0.18 and P(R)=0.2, find P(Q or R). A)0.036 B)0.344 C)0.380

Perform the indicated operation. -6 + 6 0 -12 12

the archean eon spans the time from the formation of the earth until _____ years ago

The what circulation disperses oxygen rich blood throughout the body.

what is the algebraic expression of one fourth of a number n?

what time period did the summer of chasing mermaids take place