chey610 chey610
  • 13-09-2017
  • Mathematics
contestada

How many more stickers are on maddies notebook than on megs notebook

How many more stickers are on maddies notebook than on megs notebook class=

Respuesta :

22lauraholcombow60nd
22lauraholcombow60nd 22lauraholcombow60nd
  • 13-09-2017
10, because then meg would have 5. 
Answer Link
harleyj1428 harleyj1428
  • 13-09-2017
Maddie has 10 stickers. Meg has 5 stickers. 5+10=15
Answer Link

Otras preguntas

What is the volume of this cylinder? Use 3.14 and round your answer to the nearest hundredth. 6 in 2 in cubic inches
can people live without cellphones ? Essay do in 3 hours !!!
Dada la función: P(x) = 2x³ + ax² + (-3a + b)x + 8 a) Hallar a y b sabiendo que P(2)=12 y que P(x) es dividido (x+3) da resto 32 b) Resolver P(x)=0 y escribir d
What life lessons do we learn from the Player in Act II?
An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated
Choose the correct homophone to fill in the blank in the sentence below. He has a stomach ache because he ate many blueberries. A. to B. too C. two D. tew​
48 es un número irracional
which statement describes rationing during World War II
Help, please!!!!! Major point for this assignment
A boat on a river heads North East at a speed of 50 m/s at an angle of 35 degrees. What is the velocity's horizontal component?