aKidNamedCudi aKidNamedCudi

12-03-2021
Physics

contestada

How much work does a student (m = 60 kg) do when he Climbs a mountain 1.2 km high?

Respuesta :

zephyrusxrs zephyrusxrs

12-03-2021

Answer:

w=mgh

=60*9.8*(1.2*1000)

=705600 joule

Explanation:

Answer Link

Otras preguntas

what are some of the specific achievemnts from the golden age of islam how did they help to contribute to islams golden age

Change this verb from the present tense to the preterite tense. Miguel y Ana llegan (1 point)

Outlining is the first step in writing an essay answer. It is true not false

The area of a rectangular swimming pool is 10x2 – 19x – 15. The length of the pool is 5x + 3. What is the width of the pool?

which group believed that the new constitution did not give you the power to the states

A 10-kilogram bicycle is traveling at a speed of 2m/s. what is the bike's kinetice energy?

for a wind farm to be affective it needs to be in a place with __________? a. constant wind b. no wind c. high average wind speeds d. low average wind speeds

Fifty years ago, bed bugs were nearly eliminated in the United States by using of pesticides like DDT. Today bed bugs are back in beds and theaters. DDT is no l

The __________ has become closely associated with New Zealand’s identity, and is also an important export crop. a.clementine b.pineapple c.kiwifruit d.coco

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the