kinghyat kinghyat

12-02-2021
Mathematics

contestada

Find the slope of the line passing through points (5,6) and (-5, 6)

Respuesta :

kritika3375 kritika3375

12-02-2021

Step-by-step explanation:

Let

(x1 , y1 ) = ( - 5 , 6)

(x2 , y2) = ( 5 , 6)

Slope (m)

= ( y2 - y1) / (x2 - x1)

= ( 6 - 6) / (5 + 5)

= 0 / 10

= 0

Answer Link

5926008032 5926008032

12-02-2021

Answer:

0

Step-by-step explanation:

Answer Link

Otras preguntas

Which figure shows the correct dimensions of a 14 scale drawing of the given figure?

Consider the reaction of magnesium metal with hydrochloric acid to produce magnesium chloride and hydrogen gas. If 3.56 mol of magnesium and 3.56 mol of hydroch

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the

The natural tendency of molecules to move from higher to lower concentrations is?

The thermosphere protects the Earth from UV radiation coming from the Sun. Please select the best answer from the choices provided T F

5x2=5x^2 4x2+4x^2 1. What values of a, b, and c would you use in the quadratic formula for the following equation? 5x2+9x=4 2. attachment 3. What are the appro

How did Tokugawa rule affect the common people of Japan

Quadrilateral JKLM has vertices J(–7, –2), K(–2, –2), L(–3, –4), and M(–6, –4). Find the midpoints of each of the sides JM andKL.

not a question but im done with this app so if you are nuce can you please not repky to my question earlier

Alexandra paid \$7$7dollar sign, 7 to park her car for 333 hours at the parking garage. The garage charges an hourly parking rate. Write an equation that shows