sophiapil3436 sophiapil3436

16-04-2020
Business

contestada

Create. a formula with structured references to calculate the percentage of the sticker price in column e

Respuesta :

maranathaoye maranathaoye

20-04-2020

Answer:

Explanation:

To achieve this:

Start by subtracting the original value from the price the buyer purchased, then divide it by the original value. Format this data to percent style leaving it in 1decimal place.

Answer Link

Otras preguntas

What drawings show the exterior of an assembled machine?

Which best describes the outcome of the siege of Petersburg?

A rate of 4 centimeters per second is equal to how many meters per hour?

p: Two linear functions have different coefficients of x. q: The graphs of two functions intersect at exactly one point. Which statement is logically equivalen

Answer ASAP Find the area for this shape

If there are no emergency conditions present, law enforcement officers should obtain a ____________ before conducting a search. A. Suspicion B. Hunch. C. Warran

The sculptural process in which the artist carves only in shallow depth is called ________. a. freestanding b. high relief c. in the round d. pinch e. bas-relie

Which artist carried the "organic principle" the farthest, incorporating it even into the structure of his architecture?

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

Which one of these characteristics of beer on the first wave of immigrants have in common