Skullking Skullking

14-03-2018
Biology

contestada

1. Replicate the following DNA segment 5’
agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

Respuesta :

Diatonic254 Diatonic254

27-03-2018

The answer is

tcgccctactcgcgtacaccgcgtattgac3’ 3’

agcgggatgagcgcatgtggcgcataactg5’

This is keeping in mind that purines (adenine and guanine) match with pyrimidines (cytosine and thymine). Adenine specifically pairs with Thyamine while Cytosine pairs with Guanine. Replication means the DNA is being duplicated therefore, the main enzyme is DNA polymerase. Were it transcription (involving transcription to RNA), adenines would match with Uracil

Answer Link

Otras preguntas

What was General Winfield Scott’s strategy for winning the war with Mexico?

Problem Solving | Should your directions to a friend for traveling from one city to another include displacements or distances? Explain.

lisa makes 14 pounds of clay for art class. she uses 6 pounds for a project. she gives 1/5 pound to each of the other students in art class. how many other stud

Which outstanding U.S. army officer chose to lead Confederate forces out of loyalty to his state? A. George B. McClellan B. Robert E. Lee C. Ulysses S. Grant D.

Write a ratio equivalent to 30/45 that has lower terms.(Which one is right, please help!) A. 6/15 D.45/39 B.31/46 E.10/9 C.10

The product of 10 and three more than a number. As an algebraic expression.

Does anybody know any names of animals that rhyme with head? I need to fill in the blank: They have a great big skeleton, not of a human or a ____, but of big g

Which word correctly completes the sentence? While waiting for his parents, Toby read __________ of the book. A. a lot B. alot

Which factor most determines the role of the United States in the global economy? a. The United States has the largest national gross domestic product in the Wo

Find the missing dimension of each figure Parallelogram: h= 5 1/4 ft; a= 12 ft 2