itsjustraven itsjustraven

13-03-2020
Biology

contestada

The separated strands of DNA are completed into two double helixes by DNA _________.

helicase

polymerase

Respuesta :

jarviskaya2004 jarviskaya2004

27-03-2020

Answer:polymersae

Explanation

Answer Link

drakemccorkle100 drakemccorkle100

10-05-2020

Answer:

polymerase

Explanation:

Answer Link

Otras preguntas

Name two hormones secreted by the adrenal medulla.

Dahlia has been having chronic headaches and she is behind in all her classes. For the past six months her job has been extremely stressful, but she doesn't fee

A guest is asking questions that another employee is unable to answer. You know the answers, but the other employee has not asked for help. What would you do?

The formation of condensation on a glass of ice water causes the ice to melt faster than it would otherwise. If 8.55 g of condensation forms on a glass containi

Mullineaux Corporation has a target capital structure of 70 percent common stock and 30 percent debt. Its cost of equity is 16 percent, and the cost of debt is

A hydrogen-like ion is an ion containing only one electron. The energies of the electron in a hydrogen-like ion are given by the following equation where n is t

Baskets Inc. gathered the following actual results for the current month: Actual amounts: Units produced 6000 Direct materials purchased and used (7600 lbs.)

Which of the following is a part of the dura mater. a. internal periosteum of the bony cranium b. the falx cerebri c. falx cerebelli d. all of the above e. b an

During translation, what sets up the open reading frame in mRNA? What will it correspond to in DNA?

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3' a) 5' CTGTATCCCAGACGGATATAACT 3' b) 5' TCAATATACCGTCTGGGTA