brieKrasa7gmg2 brieKrasa7gmg2

15-02-2016
Geography

contestada

The active sections that are located along fault lines are called
a. recurrence gaps.
b. stress accumulations.
c. seismic risks.
d. seismic gaps.

Respuesta :

taskmasters taskmasters

28-02-2016

The active sections located along the fault lines are called seismic gaps, letter D. Seismic gaps are segment of an active plate that has not recently deformed and is likely to cause earthquake in the future.

Answer Link

Otras preguntas

Use the following equations to solve the problem. final distance = initial distance + (speed × time) df = di + vt 1.00 mi = 1.61 km For an initial distance of 1

The body contains exactly 150 muscles. True False

An advantage of sexual reproduction over asexual reproduction is that sexual reproduction

which of the following motor skills is LEAST likely to be used when a soccer player races his opponent to kick a moving ball.

1. Name of transportation 2. Source of energy 3. How energy was converted 4. Disadvantages that were present

Which sentences in the passage are punctuated correctly? Here are some more questions I would like to ask Representative Weaver, If the driving age is raised to

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3

Who's wrong? I think the correct numbers would be 17 and 18, not 18 and 19.

Which theme of Romeo and Juliet is best supported by this excerpt? 1.Tragedy is often caused by people misunderstanding each other. 2.Tragedy causes people to

How does being a hermaphrodite help an earthworm reproduce