rsuperstar5862 rsuperstar5862
  • 14-09-2017
  • Mathematics
contestada

When the prefix milli is used, it means multiply the number by ? ?

Respuesta :

Аноним Аноним
  • 14-09-2017
1 meter  = 1000 millimeters

so,  5 meters   = 5*1000 = 5000 millimeters

and  6000 millimeters = 6000 / 1000 = 6 meters
Answer Link

Otras preguntas

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds
Which excretory organ filters the blood to remove excess water, urea, and cell waste?
Find the value of side a . 30 being the hypotenuse, 24 being the adjacent, and a being the opposite of the right triangle
a direct result of United States involvement in World War II was?
Calculate the wavelength λ1 for gamma rays of frequency f1 = 6.90×1021 Hz
Write an equation for the conic section. Circle with center (1, 1) and radius 5
Skeletal muscle fibers contain striations. what is the best description of a striation?
Ammonia can be produced by bacteria in the soil by two processes
hi i need an essay about a description of a needy child found on the street... pls help
Because of his attention to the rights of the French People, King Louis-Philippe is referred to as ________ . THE ANSWER IS MY BUTTHOLE NOW EVERYONE NEEDS TO TH