bbyyadrii bbyyadrii

11-03-2017
Geography

contestada

Identify where volcanic regions and hot spot volcanoes are found on Earth's surface, AND why they are found there.

Respuesta :

darkkangell5 darkkangell5

11-03-2017

volcanic hot spots and regions are mainly found where tetonic plates meet (converge,diverge or sink).this where the earth crust is connected to the mantle.where hot magma can escape to the surface forming volcanoes

Answer Link

Otras preguntas

How does Esperanza's perspective in paragraph 16 contribute to the mood of the story 3 A It creates a humorous mood by emphasizing Esperanza's silly and selfish

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

In 1898, what were the specific interest of the United States in Cuba? We’re they legitimate and significant enough to warrant intervention?

Given 2cos^2(x) + 5cos(x) = -2, find all solutions in exact form in the interval [-2π, 2π]. Show all work, and sketch a graph to verify your answers.

How might the reversal of Earth's magnetic poles affect life on Earth? Make sure to consider the role that the magnetic poles play in daily life and the importa

7 x - 7; x = 4!!!???

Find the x- and y-intercepts of the graph of x+y=18. State each answer as an integer or an improper fraction in simplest form

√54²-43.8² +2(7) What is the height of the space Lilly needs? Round to the nearest hundredth. 18.52 24.20 45.58 235.06

convert these measurements to centimeters : (a)73.1 cm and (b) 0,0012km

7(u - 4) = 28 solve for u simplify your answer as much as possible