oliviajacobs226 oliviajacobs226

17-02-2017
Biology

contestada

Succulent plants store water. Given this characteristic, which biome would they be best suited to live in?

Respuesta :

Аноним Аноним

17-02-2017

A desert biome, because since it can store water it wouldn't need a lot of water to survive, and deserts don't have very much rainfall.

Answer Link

Аноним Аноним

30-10-2018

A desert biome. hope this helps. :)

Answer Link

Otras preguntas

Which is a unit rate? A. 75 miles per 5 gallons B. Typing 35 words per minute C. $8.00 for 3 bottles of soda D. 7 pounds in 3 bags

please help me best answer gets brainliest

May 28, 1830, first major legislative departure from the U.S policy of officially respecting the legal and political rights of the American Indians. The act aut

A restriction enzyme is coded for: AT!GC How long would the Base Pair fragments be for this DNA sequence? AGTCGAGTATATGCATGGCCGCGAT 1)25 and 0 2)25 and 25 3)14

The only force acting on a 2.0 kg canister that is moving in an xy plane has a magnitude of 6.0 N. The canister initially has a velocity of 2.2 m/s in the posit

Gerold's Travel Service just paid $1.79 to its shareholders as the annual dividend. Simultaneously, the company announced that future dividends will be increasi

Please Help Guys/Girls

Walker was gathering information on Ultra HD 4K and LCD TVs because he wanted to purchase one for his household. He bought several electronic product magazines,

Melissa is four times as old as Jim. Pat is 5 years older than Melissa. If Jim is y years old, how old is Pat?

The rise of nationalism as South America divided into several countries happened a) at the same time b) before c) soon after d) 100 years later