riddhiamin9 riddhiamin9

12-09-2022
Mathematics

contestada

Translate to an equation. Then solve the equation.
Seven times the difference of some number and 2 amounts to the quotient of 112 and 8.

Respuesta :

100030909 100030909

12-09-2022

Answer: 7(x-2(112/8))= 7(x-28)= 7x - 28*7

7x = 28*7

x=28

Answer Link

morgan587262 morgan587262

12-09-2022

7(x-2(112/8))= 7(x-28)= 7x - 28*7

Answer Link

Otras preguntas

A mace is commonly used at a university or college convocation ceremony. The mace was originally a weapon, then became the symbol of government, and now has bec

I don't understand how to do this. Can I please have some help?

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3' a) 5' CTGTATCCCAGACGGATATAACT 3' b) 5' TCAATATACCGTCTGGGTA

The human body has about 10 bacterial cells for every eukaryotic cell. Bacteria coat our skin, gut, and mouth. Also present are protists, Archaeans, and viruses

There are 2.60 x 1015 short tons of oxygen in the atmosphere ( 1 short ton = 2000 lb). How many metric tons of oxygen are oresent (1 metric ton =1000 kg) ?

What is the reciprocal of 9 1/4 ? A. 49 B. 3 7/4 C. 4 3/7 D. 9 4/1

Presidents are granted advisers and cabinet members. One of the most powerful entities for helping a president to prepare a budget to present to Congress is:

PLZ HELP Solve for x: −4x − 4 = −4(x + 2) 0 −4 All real numbers No solution

Which of the following statements is FALSE regarding glycolysis? A) Glycolysis produces two net molecules of ATP. B) Glycolysis involves the oxidation of NADH

The less-movable end of a skeletal muscle is the A) insertion. B) belly. C) origin. D) proximal end. E) distal end.