vvillarreal63 vvillarreal63

14-07-2022
Chemistry

contestada

The volume of 0.6305 kg of a liquid is 0.430 L. What is its density in g/mL

Respuesta :

razorsharptip razorsharptip

14-07-2022

Answer: 1.466 g/mL

Explanation:

[tex]\frac{0.6305 \text{kg}}{0.430 \text{L}} \cdot \frac{1000 \text{g}}{1 \text{kg}} \cdot \frac{1 \text{L}}{1000 \text{mL}} = 1.466 \,\frac{\text{g}}{\text{mL}}[/tex]

Answer Link

Otras preguntas

Write a real world situation that could be modeled by the expression, 300+7x.

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

All of the following are qualities of a good friend EXCEPT: A. Similar interests B. Sometimes unkind C. Trustworthy

S’il vous plaît de l’aide pour cette exercice merci d’avance .

What are some traits in domestic abusive relationships that can be found? what are diffrent types of abuse in realationships?

1. What did state senator Art Wittich do that was illegal? 2. Why was it illegal? According to state or federal law -- or both? 3. How did he get caught? 4. Wha

write a formal letter invitation letter to ur formal English teacher inviting him overfor your upcoming inter house sport

4. The first three terms of an infinite geometric sequence are m – 1,6, m + 8. (a)write down two expressions for r. (b) the find two possible values of m. (c) H

how does increase in productivity result in decrease in cost of production? please give me a simple answer

Write the equvalent fractions using 35 as a common denominater