25roev05 25roev05

11-02-2022
Biology

contestada

What is the mRNA transcript if the complementary DNA is TCTGAG?

Respuesta :

10818570 10818570

11-02-2022

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

Answer Link

Otras preguntas

Summary of the journey to find a way to save the country (time, place)

Find the 5th (not fourth) of given geometric sequence. 2000, 1000, 500,...

A composter in the shape of a rectangular prism with dimensions 1.5 m by 1.2 m by 1.0 m is made from plywood. What area of plywood is needed to build the compos

find the volume of the prism

find the missing length indicated.

$9500 is invested, part of it at 11% and part of it at 8%. For a certain year, the total yield is $937.00. How much was invested at each rate

Help me please I’m in need of help

ls Carbon dioxide needed for photosynthesis

Who sparked the independence movement in Mexico? .

How would I do the last question if the equation of the graph has been given? Could you please explain the last problem step by step if possible?