razrpulse8 razrpulse8

13-12-2021
History

contestada

What was one the key principles of Enlightenment philosopher John Locke?

Write your response in one to two complete sentences.

GIVING BRAINLY

Respuesta :

kickdoejayy kickdoejayy

13-12-2021

One of the key principles of john locke was the idek of divine right. Divine right is the idea that God chose the people who who rule on earth and you could not rule unless god appointed you.

Answer Link

Otras preguntas

Opening of sodium channels in the membrane of a neuron results in A) depolarization. B) repolarization. C) hyperpolarization. D) increased negative charge i

What is produced from Transcription and Translation? Where do transcription and translation each take place? Why is translation called “translation?”

How did Leonard Bernstein advance music in the United States and throughout the world?

The client states, "After all my goofing around, if I can't pull myself together to study and do well on this paper, I'm going to flunk out of college. I can't

A basketball coach will select the members of a five-player team from among 9 players, including John and Peter. If the five players are chosen at random, what

How does a firm in perfect competition identify profit maximizing output levels? How does this differ from profit maximization levels of output in a monopoly?

Replicate the following DNA strand: 5' ATTGCGAACTGCGAGGACTTC 3'

1 /4, 4/9,9/16,16/25,... please find the next two terms, nth term and 10th term of the given sequence.

Which of the following sentences contains informal, rather than formal language? The lead engineer found out the cause of a lot of the problems. The artide exam

What is the definition of wispy