juliehopkin22 juliehopkin22

14-05-2021
Mathematics

contestada

If mZNOP = 24° and mZNOQ = 110°, what is mZPOQ?

If mZNOP 24 and mZNOQ 110 what is mZPOQ class=

Respuesta :

Sashakay Sashakay

14-05-2021

Answer:

POQ= NOQ-NOP

=110-24

=86°

Answer Link

Otras preguntas

A beta of 1.1 means that for a given 1 percent change in the value of the market, the _______ is expected to change by 1.1 percent in the same direction.

In addition to subaverage intellectual functioning, a diagnosis of _____ requires that a child show deficits relative to his or her age group in at least two of

You have recently been hired to advise the owners of Kenfield Insect Ltd. (KIL), which operates in a perfectly competitive industry. KIL is currently producing

Replicate the following DNA strand: 5' ATTGCGAACTGCGAGGACTTC 3'

Some of the main sources of land pollution include: A. chemical leaks B. oil refineries C. people D. A and B E. A, B and C

Read the excerpt from "An Indian's View of Indian Affairs." My father was chief before me. When a young man, he was called Joseph by Mr. Spaulding, a missionary

Why was Thomas Paine‘s essay common sense significant to American independence

What is the correct name of the compound Hg2CrO4? (a) Mercury(l) chromate (b) Mercury(ll) chromate (c) Mercury dichromate (d) Dimercury chromate (e) Monomercury

For what type(s) of compound do we use Roman numerals in the name?

how does the gelug sect of buddhism view the dalai lama