ritaacharya100 ritaacharya100

15-02-2021
History

contestada

What is the secret of the picture of monalisha?

Respuesta :

alexcnichols alexcnichols

15-02-2021

Answer:

the secret is being able to spell mona lisa correctly

Explanation:

Answer Link

kincaidmadison5 kincaidmadison5

15-02-2021

Answer:

One long-standing mystery of the painting is why Mona Lisa features very faint eyebrows and apparently does not have any eyelashes

Answer Link

Otras preguntas

The sales era emerged because of an increased need to move products during the Great Depression. True False

Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t

Which scientist discovered the neutron and gave us the current basic model of the atom? A James Maxwell B John Dalton C James Chadwick D Sir Isaac Newton

What are some ideas from the Enlightenment that went into the Constitution??

For 10 Points, Identify the following verbs by number and person by checking the appropriate boxes. They see no other solution to the problem. A) second person

Which of the following is not acceptable formatting for the works cited page? A single space B alphabetical order C double space D first line at margin Please s

Hello, I would like to protest here in brainly for women's rights and BLM. If you support this cause please comment on any questions here on brainly "Include wo

Choose the appropriate word to complete each sentence. classe -le même -strict -d’accord- copains - comment 1. Le prof est assez _______ . 2. Les deux amis sont

Multiply each pair of factors. Type the product in the space provided (6 + 3)(6 - 31) (4-57)(4+ 5) - (-387)(-3 - 81) -

Which of these is the equation of a line with y-intercept (0,2) and slope 1/3