jasonvorheese4966 jasonvorheese4966

12-02-2021
History

contestada

a shift in demand moves the same direction as ______. A.supply B.price C.quantity D.quality

Respuesta :

yarii775 yarii775

12-02-2021

the answer is quantity (D)

Answer Link

Otras preguntas

Is philosophy really necessary in business?

The diameter of Jupiter is about 1.43•10^5km. The diameter of the Earth is about 12,700km. About how many times greater is the diameter of Jupiter that the diam

What is the shaded area???

When copper sulphide ares are roasted in a furnace, sulphur dioxide SO₂, forms. What is the molar mass of SO,?

What makes a method accurate or inaccurate?

The purpose of the break in the middle of the lines of Old English poetry - called a "caesura" - is A. to make the lines look good graphically. B. to serve a po

Scale 2/5 by the factor of 4.

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

Estimate the average rate of change from x = 4 to x = 7.

Kelsey has an orange ribbon and a blue ribbon. The orange ribbon is 7 11/12 inches long and the blue ribbon is 17 5/12 inches long. How much longer is the blue