contestada

The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***.

5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'

What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).

note: there are two answers for this question

Respuesta :

annyksl

Answer:

5'GATCGTAA3'

5'ATTCTAGA3'

Explanation:

As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.

Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.

DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.

Otras preguntas