juarezyonatan116 juarezyonatan116

12-11-2020
Biology

contestada

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were

GTA TAA mRNA UCA CAU AUU tRNA AGU GUA UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below 1 DNA G class=

Respuesta :

jakemiller12 jakemiller12

12-11-2020

Answer:

u want step by step?

Explanation:

Answer Link

Otras preguntas

I WILL MARK BRAINLEST HELP

Please help me please

which compound is soluble in excess ammonia solution. A. Copper (II) sulphate B. iron (II) chloride. C.Magnesium chloride. D. Magnesium Chloride

What was the meaning of the Albany Plan? A. The colonies needed to join together to kill the British.B. The colonies would all die from no food.C. The colonies

Gina Morales had taxable income of $35,950 in 2020. She will file a return using the single filing status. Her income consisted of ordinary and qualified divide

3/8 is found between which pair of fractions on a number line

Quadrilateral ABCD has the following angle measures. Find the Measure of angle A. B: 59° C: 103° D: 100°

which type of information could reasonably be expected to cause serious damage to national security if disclosed without authorization

Solve for x. 100° (2x+3) 51°

A response strategy requires suppliers be selected based primarily on A. being willing to share information. B. capacity, speed, and flexibility. C. cost. D. pr