haydenrosejackson1 haydenrosejackson1

15-10-2020
Biology

contestada

What is the complementary strand for this segment of DNA? I'll give u 15 point pls answer

What is the complementary strand for this segment of DNA Ill give u 15 point pls answer class=

Respuesta :

zayveionbrown zayveionbrown

15-10-2020

I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC

Answer Link

Otras preguntas

A 15 kg soccer ball is kicked with a velocity of 8 m/s, what is the momentum of the ball?

Word problem please help thank you

on zeba's birthday,her uncle gift her two new dolls. in how many ways can zeba arrange all her dolls on 6 shelves, placing one doll on each shelf?if she has 4 d

Find the value of x and y.

just need to know the fraction

What is Duma¿¿¿ thanks for answer

if i had 2 cats and my mom bought me 4 dogs how many animals is that in total

How do plasmodesmata affect the individuality of the cells?

Describe the for forces of evolution.

What is the purpose of studying such events going on in Gulf of Mexico and the dead zones?the subject is ( Earth Science)