sophiafriend34 sophiafriend34

15-05-2020
Biology

contestada

Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Respuesta :

queenb74 queenb74

15-05-2020

The answer is DNA I know because I know

Answer Link

savitar0291 savitar0291

15-05-2020

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

Answer Link

Otras preguntas

How did Reagan's Cold War strategy change after Gorbachev took power? Reagan began to focus more on military buildup. Reagan agreed to ban some nuclear missiles

In explaining other people’s behaviors people from western cultures tend to emphasize blank factors and people from eastern cultures tend to emphasize blank fac

Some basic properties of eigenvalues. Show the following: a) The eigenvalues of A and AT are the same. b) A is invertible if and only if A does not have a zero

A_____ is a scale which looks much like a major scale, but begins on a different scale degree. music class

Solve by using the measurements ∠PQR = 90°, ∠QRP = 80°, and r = 15. Round measures of sides to the nearest tenth and measures of angles to the nearest degree.

The probability of winning on an arcade game is 0.612. If you play the arcade game 21 times, what is the probability of winning no more than 10 times? (Round yo

A volcano forms in the middle of the Pacific Ocean. Over time, the lava hardens, and the volcano becomes dormant. The result is a large island. Describe the ini

an object begins at a position of 3.25m and ends at 9.66m what is its displacement

What is the value of 4( 3x + 5) when x= 11?

During isovolumetric relaxation, what opens the AV valves?