Wosito1 Wosito1

12-05-2020
Biology

contestada

How can contact with animals negatively impact humans? In what ways does contact or working with animals benefit humans?

Respuesta :

Ally67562 Ally67562

13-05-2020

Answer:

Humans are now responsible for causing changes in the environment that hurt animals and plant species. We take up more space on earth for our homes and cities. Human activity often changes or destroys the habitats that plants and animals need to survive.

Explanation:

Answer Link

Otras preguntas

Naturalizer Shoes Are the Best Naturalizer shoes are more comfortable than other brands and look just as stylish. The comfort is provided by a cushy padding un

Which of the following was included in the procedure that Flemming used to test his hypothesis? Select the 3 that apply

How did Islam begin?

Name a pair of vertical angles.Vert

Water boils at different temperatures at different elevations. The boiling temperature of water is 212F at sea level (0 feet) but drops about 1.72F for every

Use textual evidence to support your answers. 1. Describe the reunion between Lear and Cordelia (4.7.). When they are taken prisoner together (5.3.), what does

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

7. Which statement below is not an economic impact of the North American Free Trade Agreement? (1 point)

Select True or False for each statement. A right triangle always has obtuse exterior angles at two vertices.

Matt is wearing Rollerblades. Beth pushes him along a hallway with a large spring, keeping the spring compressed and consequently the force that the spring exer