rosalia2020 rosalia2020

12-05-2020
Biology

contestada

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
What is the cellular process shown (mRNA to amino acids?) where in the cell does this process take place?

Respuesta :

samchavez8277 samchavez8277

18-05-2020

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

Answer Link

Otras preguntas

What are the pros and cons of the monetary policy and what is the basic goal of the monetary policy?

Using the Fusion Center website, identify a center that serves your state. Describe the fusion center. List the participating agencies and describe their missio

All of the following describe controlled thinking except: A) Effortless. B) Conscious. C) Requiring mental energy. D) Considering only one thing at a time.

You heard my reading of "Jack and the Beanstalk" or rather of a psychoanalytic treatment of this plot by a Freudian scholar. My skeptical attitude toward that i

"What is the only number that is its own square root?"

Plants can reproduce in various ways, but especially through the use of , like brightly colored flowers or attractive scents. traits genetic plants reproduction

2. Part A: What central idea about mathematical instruction does the author express in Passage 1? (R.2.2) A. Classrooms that foster laughter, discussion, an

The area between the curve y = 2x² - 2 and the x-axis from -3,1 is 10.67 (Use algebraic methods to show your work.) A. True B. False

Which equation represents a line which is parallel to the line y-2, x, equals, 7y−2x=7?

What does technology bring to unwieldy areas of business, allowing them to function more efficiently?