hala1572 hala1572

11-05-2020
Geography

contestada

How did china help it’s self protect from the situation happening now

Respuesta :

13-05-2020

Answer:

More people in China are staying inside and if they do go outside of their shelter, they are forced to put safety on at all times. The government in China is more strict than the one in (for example) the United States of America.

Explanation:

Hope that gave you an idea of your question. Good luck!!

Answer Link

Otras preguntas

Two children are throwing a ball back and forth straight across the back seat of a car. The ball is being thrown 8 mph relative to the car, and the car is trave

Quadrilateral VRPO is a kite. If VN = 35 and RN = 12, what is VO?

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3' a) 5' CTGTATCCCAGACGGATATAACT 3' b) 5' TCAATATACCGTCTGGGTA

If households pay $1,000 in interest payments and receive $1,200 in interest, wages equal $8,000,rental receipts on land are $200, total business profits before

Scientists have identified dozens of pheromones used by honeybees for communication. Which type of sensory system are pheromones used in? A. electroreception B.

_____ seeks to make all aspects of the inmates’ environment part of their treatment and to minimize differences between custodial staff and treatment personnel.

Find the area of the shaded region.

Air at 80 kPa, 27Â°C, and 220 m/s enters a diffuser at a rate of 2.5 kg/s and leaves at 42Â°C. The exit area of the diffuser is 370 cm^2. The air is estimated t

Read the excerpt from chapter 4 of The Strange Case of Dr. Jekyll and Mr. Hyde. Presently her eye wandered to the other, and she was surprised to recognise in h

When iron is deficient, ________________________ cannot be produced, causing malformed red blood cells, the inability to deliver adequate oxygen to tissues ulti