brian38 brian38

13-08-2016
Mathematics

contestada

sam is building a model of an antique car. The scale of his model to the actual car is 1:10. His model is 18/1/2 inches long. how long is the actual car.

Respuesta :

TripleThreatRM TripleThreatRM

13-08-2016

The actual car is 15 feet and 5 inches long.

Answer Link

Аноним Аноним

13-08-2016

1:10=1/10 since the car is the model we wil multiply by 10 not 1/10
10*18.5= 185 inches

Answer Link

Otras preguntas

Explain why the sodium-potassium pump and the proton pump are considered to be electrogenic. Does each pump move equal or unequal numbers of positive and negati

The definition of a circle uses the undefined term _______. A. arc B. line C. plane D. ray Could you please explain your answer as well? Thank you and I appreci

how can you use a career portfolio personally

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3' a) 5' CTGTATCCCAGACGGATATAACT 3' b) 5' TCAATATACCGTCTGGGTA

Initially, 0.65 mol of PCl5 is placed in a 1.0 L flask. At equilibrium, there is 0.15 mol of PCl3 in the flask. What is the equilibrium concentration of PCl5? E

In which direction does RNA synthesis proceed?

On being heated with a solution of sodium ethoxide in ethanol, compound A (C7H15Br) yielded a mixture of two alkenes B and C, each having molecular formula C7H1

A 1.00-L sample of carbon tetrachloride has a mass of 1.58 kg. What is the density of this substance in g/cm3?

The committed and regulated step of cholesterol synthesis is the enzyme __________ which is an important target for a class of drugs called statins that can dra

What is conserved in this reaction? N2(g) + 3F2(9) 2NF:(9) O mass and atoms O moles only O atoms only O mass only