stefanieloney stefanieloney

14-04-2020
Biology

contestada

A restriction enzyme is coded for: AT!GC

How long would the Base Pair fragments be for this DNA sequence?

AGTCGAGTATATGCATGGCCGCGAT

Question 1 options:

14 and 11

12 and 13

25 and 0

25 and 25

thanks

Respuesta :

exspressgirl27oz2xjv exspressgirl27oz2xjv

21-04-2020

Answer:the answer is 12 and 13

Explanation: You count the A and T together, which is 12, then you count the G and C together which is 13. I just took this on my test and got it correct

Answer Link

Otras preguntas

The federal government routinely regulates immigration into the United States. Where is the power to do this found in the U.S Constitution? A) Expressed powers

What does the value of y have to be so that (3, y) and (-5,6) have a slope of -1 between them?

Which factor listed below is NOT considered scientific evidence for global warming? A) data from retreating glaciers B) average increase in global temperatures

Need help with paraphrasing one e-mail. I have one e-mail, and need to paraphrase it in own words. PLEASE HELP

QUESTION 2hat is an appropriate question for qualitative descriptive statistics?a. What are the frequencies and percentages of men and women in the sample?D.Wha

How does the electron gas theory explain metallic bonding.

Jonathan wants to buy a lid for his frying pan. The diameter of the pan is 10 inches. What is the approximate circumference Of a lid that will fit his frying pa

what type of climate does queenstown New Zealand have out of these choices

If potential energy at point A is 12 joules, what is the potential energy at D? P.E. = 2.4 2 3

Whats the answer to -x² +6x + 18 = 0