zach3647 zach3647

13-04-2020
Mathematics

contestada

Three times a number is equal to 12 less than the number. Find the number.

Respuesta :

val19901 val19901

13-04-2020

Well (three times four is equal to twelve. So the answer should be 4

Answer Link

Otras preguntas

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3' a) 5' CTGTATCCCAGACGGATATAACT 3' b) 5' TCAATATACCGTCTGGGTA

The temperature at pointâ (x,y) on a metal plate is Upper T left parenthesis x comma y right parenthesis equals 144 x squared minus 144 xy plus 36 y squared. An

Each person in a large square occupies, on average, 2.5 sq. feet of space. Estimate the number of people that can comfortably stand on the gym floor if the gym

T is tall while t is short. Choose all the genotype(s) for tall individuals. A. TT B. tt C. Tt D. TTTT

If the demand for loanable funds shifts to the left, what will happen to the equilibrium interest rate and the equilibrium quantity of loanable funds? both inc

Which of the following is true about red muscles? A) Red muscles are slower than white muscles. B) Red muscles have fewer mitochondria than white muscles. C)

Express each ratio as a fraction in simplest form 1. 13 oranges to 26 apples 2. 12 inches to 3 feet

give me the times table for 8 Give me answer asap

The grey matter of the cerebral hemispheres are located: a. on the surface b. deep within each cerebral tissue c. in the occipital lobe d. a and c only e. none

Bonita Industries has estimated that total depreciation expense for the year ending December 31, 2018 will amount to $583000, and that 2018 year-end bonuses to