drizzyizzydem816 drizzyizzydem816

15-11-2019
Physics

contestada

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

Respuesta :

15-11-2019

Explanation:

Well A-T have a complementary shape

And C-G have a complementary shape

So replace all Ts for A, and all As for Ts

Replace all Cs for Gs, and all Gs for Cs

You get"

TAACCGGTAACCTTATGGTCAGCTCCGGTGGCTCCGGAATG

Answer Link

Otras preguntas

Examine a Centers for Disease Control (CDC) advertising campaign that promotes the influenza (flu) vaccination. Analyze the campaign to discover the target aud

I went camping this summer. did not like the insects. I did not like sleeping on the ground. Which is the best way to combine the sentences? 1 of 3 QUESTIONS I

A compression rate of 100-120 per minute should be performed when providing cpr. True or false?.

A solution of NaOH has concentration of 1.2M then mass of NaOH in g/dm3 is

Describe a sensory experience (listening to music, eating an apple, stubbing your toe, etc.) and explain how the perception is influenced by both bottom-up and

In the mid-1800s, steam power was replaced by

Which of the following statements is false? A. A rectangle is an equiangular quadrilateral. B. A rhombus is a quadrilateral. C. A square is a rectangle. D. Oppo

Let's have cha edqukdbpon

Denver, Colorado, is 5,183 feet above sea level. Convert the height to miles. Round to two decimal places.

What is hyperconjugation