contestada

The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the primer that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Respuesta :

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Otras preguntas