el654321 el654321

16-01-2023
Mathematics

contestada

Let a function
of 2 variables be defined by h(x, y) = x² + 3xy-(y-x), what is the value of h(5,4)

Respuesta :

Otras preguntas

Select the indicated values on the graph, by using the ‘point’ tool above the graph and then placing a point on the graph where the y-value is one of the follow

Now, write a three-paragraph editorial, keeping in mind the guidelines you just learned

Lesson 2 Assessment 2. For each key term or person in the lesson, write a sentence explaining its significance.

i would really appreciate it, if I can get some help! Please look at both photos!

Use the graphs of y = f(x) and y = g(x) above to the find the function value. (a) (gof)(3) = (b) (gog)(0) =

Please help me I really need help. ILYSM THANK YOU :) How many pounds of apples will he get if he goes to David’s orchard?

Bill Gutierrez drove 130 miles at a speed of 65 miles per hour on an expressway for 2 hours. He drove 67.5 miles for 1.5 hours at 45 miles per hours on a state

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

Match each product life cycle stage to its description.

You make a scale drawing of a banner for a school dance. You use a scale 1 inch= 3 feet. What is the actual width of the banner