sunnyluvrena sunnyluvrena

12-12-2022
Biology

contestada

5'
GCCATATATATAATTGTGGCCATGGGGCAAGTCCCCAAGGCGACCCTATAGGGGGCG 3'
3' CGGTATATATATTAACACCGGTACCCCGTTCAGGGGTTCCGCTGGGATATCCCCCGC 5'

18. Explain the type of nucleic acid portrayed in the sequence of nitrogenous bases displayed
above?

Respuesta :

Otras preguntas

Determine whether the given function is a solution of the differential equation. [tex]y=\sqrt{1-x^{2}}; yy' - x = 0[/tex]

f(L,K)=10L⁰.⁴ K⁰.⁶ gives the number of widgets produced using L hours of labor and K dollars of capital. Check: f(2,3)=25.50849001 Find the number of labor hour

of one impact and explain of how floods had a negative impact on lost income because of decreasing businesses

Sheldon invested $3500 in an account that pays 4.8% per annum interest compounded monthly. The equation A=3500(1.004)^(12n) represents the value of the investme

How to write about Ville de naissance in French for certificate in French level exam

How many terms are in the expression shown? 2n + 5 – 3p + 4q 1 2 3 4

pls help! with this math question!!

Name 3 different processes/jobs that you are very familiar with. Explain them shortly. You can consider a process related to your job or your daily life. Break

I need help getting the answer for Line 2.

What were some of the advantages and disadvantages of great migration in the early 20th century? Elaborate on why African American males were subjected to so mu