aidenlumpkins219 aidenlumpkins219

13-11-2022
Biology

contestada

Using the following genomic sequence:

1) Underline each Intron

2) Circle each exon

GUUAUGAGUCGUUGGCAUUAAUCUUUCCUUAUGAUUGUCGCUGAUCGUUAG

UCGUCCAUGCGUGGUGGCUGACUUCCAAUGACCAAAUCUUCGGUGGCGGAG

UAACAUAUAAGAAUGACCAAAAGGCGUCGAUGAGGAUGUGGCAAUUAACAUC

Respuesta :

Otras preguntas

Which relationship between x and y in the equation shows a proportional relationship? A) y=x2+3 B) y=12x C) y=12x D) y=2x+6

genes that are linked together____

A basketball team sells tickets that cost $10, $20, or, for VIP seats, $30. The team has sold 3296 tickets overall. It has sold 304 more $20 tickets than

Which theory explains a person’s prejudice caused by personality type? a) Dominants groups use prejudices and discrimination against weaker groups. b)Prejudice

What, according to scholar were Poe final five words

The male elephant weighs 8,000 pounds wich is the is th same as 4 tons the female weighs 7,000 pounds how many tons does the female weighs

1.) ANALOGY -- Lithosphere: rigid as asthenosphere: ____________. A.) mutable B.) static C.) inflexible D.) unyielding 2.) What type of boundary, shown here, e

Which European country was not one of the major areas of migration?

Tatiana had 350 dollars she spent 180 dollars on herself and the rest on her presents for her family write an equation to express how much tatiana spent on her

Which of the following men was not one of the twelve disciples? John Matthew James Mark