valeriagutierrezde16 valeriagutierrezde16

12-10-2022
Mathematics

contestada

Given h (x)= |x - 2| +8 and k (x) = 3x + 2
What value of x makes h (x) = k (x)?

Respuesta :

Otras preguntas

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3' a) 5' CTGTATCCCAGACGGATATAACT 3' b) 5' TCAATATACCGTCTGGGTA

Round off each number to the indicated number significant figures (sf): (a) 00003554 (to 2 sf) (b) 35.8348 (to 4 sf) (c) 22.4555 (to 3 sf).

How could you recognize co-dominance?

4/3 b + 2 equals 4 - 1/3 be

Mrs. Johnson made $31,581 in sales commission last year. she makes $99 for every sale she completes. how many sales did she complete last year?

5. The length of time between billing dates and checks received and deposited for non-delinquent accounts of an oil company’s monthly credit card customers is 1

Utilization of the CODIS and NADNA has helped solve all crimes many cold cases many social problems many medical and disease issues NEXT QUESTION ASK FOR HELP

The correct sequence in viral reproduction is A) attachment, penetration, assembly, replication, release. B) penetration, absorption, assembly, replication, r

1. _______________ involves being fair and following the rules. 2. Sticking together when working toward a common goal is called _______________. 3. ___________

What vessel that branches off the aorta supplies oxygenated blood to the rectum? a. celiac trunk b. common iliac artery c. inferior mesenteric artery d. superio