brittney9086 brittney9086
  • 13-09-2022
  • Mathematics
contestada

Let `x=-\frac{11}{8}` and `y=-\frac{11}{4}`. which expression has a negative value?

Respuesta :

Otras preguntas

What sequence of transformations, when applied to △HIJ , shows that ​ △HIJ ​ is similar to △H′I′J′ ? dilation with respect to the origin by a scale factor of 3
Fruit flies have 8 chromosomes in their somatic cells. How many will be in the sperm cell?
What are several lands that were part of roman empire in 12 C.E
Can someone plz help
Which verb form correctly completes this sentence? Ayer, Ana y yo _________ 20.000 pesos para comprar ropa. gastamos gastaron gastaste gastó
According to maslow, adults must achieve _________ before moving on to __________.
PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se
If a government is interested in knowing the total income of its citizens (including remittances, or money earned in a foreign country and sent back home), it s
A cell with 24 chromosomes undergoes mitosis. how many cells and chromosomes will result
Which represent correct variations of the formula for speed? Check all that apply. t = s = t = s = dt d = st d =